ID: 925291765

View in Genome Browser
Species Human (GRCh38)
Location 2:2752593-2752615
Sequence CTGTGGGCAGGGAGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925291755_925291765 2 Left 925291755 2:2752568-2752590 CCACGAAGGCTCTTGGGATACAG No data
Right 925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925291765 Original CRISPR CTGTGGGCAGGGAGGGAGGG AGG Intergenic
No off target data available for this crispr