ID: 925292597

View in Genome Browser
Species Human (GRCh38)
Location 2:2757569-2757591
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925292597_925292605 19 Left 925292597 2:2757569-2757591 CCTCTCGGGCAATTCCATTCCTC No data
Right 925292605 2:2757611-2757633 TCTGTGGACAAAACAGGGGAAGG No data
925292597_925292602 14 Left 925292597 2:2757569-2757591 CCTCTCGGGCAATTCCATTCCTC No data
Right 925292602 2:2757606-2757628 TCCTCTCTGTGGACAAAACAGGG No data
925292597_925292604 15 Left 925292597 2:2757569-2757591 CCTCTCGGGCAATTCCATTCCTC No data
Right 925292604 2:2757607-2757629 CCTCTCTGTGGACAAAACAGGGG No data
925292597_925292600 3 Left 925292597 2:2757569-2757591 CCTCTCGGGCAATTCCATTCCTC No data
Right 925292600 2:2757595-2757617 TTTCTGCTTCTTCCTCTCTGTGG No data
925292597_925292601 13 Left 925292597 2:2757569-2757591 CCTCTCGGGCAATTCCATTCCTC No data
Right 925292601 2:2757605-2757627 TTCCTCTCTGTGGACAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925292597 Original CRISPR GAGGAATGGAATTGCCCGAG AGG (reversed) Intergenic