ID: 925292599

View in Genome Browser
Species Human (GRCh38)
Location 2:2757588-2757610
Sequence GAGGAAGAAGCAGAAAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925292599_925292601 -6 Left 925292599 2:2757588-2757610 CCTCTTCTTTCTGCTTCTTCCTC No data
Right 925292601 2:2757605-2757627 TTCCTCTCTGTGGACAAAACAGG No data
925292599_925292605 0 Left 925292599 2:2757588-2757610 CCTCTTCTTTCTGCTTCTTCCTC No data
Right 925292605 2:2757611-2757633 TCTGTGGACAAAACAGGGGAAGG No data
925292599_925292606 19 Left 925292599 2:2757588-2757610 CCTCTTCTTTCTGCTTCTTCCTC No data
Right 925292606 2:2757630-2757652 AAGGACGAGAAGAGACACTCCGG No data
925292599_925292604 -4 Left 925292599 2:2757588-2757610 CCTCTTCTTTCTGCTTCTTCCTC No data
Right 925292604 2:2757607-2757629 CCTCTCTGTGGACAAAACAGGGG No data
925292599_925292602 -5 Left 925292599 2:2757588-2757610 CCTCTTCTTTCTGCTTCTTCCTC No data
Right 925292602 2:2757606-2757628 TCCTCTCTGTGGACAAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925292599 Original CRISPR GAGGAAGAAGCAGAAAGAAG AGG (reversed) Intergenic