ID: 925292600

View in Genome Browser
Species Human (GRCh38)
Location 2:2757595-2757617
Sequence TTTCTGCTTCTTCCTCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925292597_925292600 3 Left 925292597 2:2757569-2757591 CCTCTCGGGCAATTCCATTCCTC No data
Right 925292600 2:2757595-2757617 TTTCTGCTTCTTCCTCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925292600 Original CRISPR TTTCTGCTTCTTCCTCTCTG TGG Intergenic
No off target data available for this crispr