ID: 925292601

View in Genome Browser
Species Human (GRCh38)
Location 2:2757605-2757627
Sequence TTCCTCTCTGTGGACAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925292597_925292601 13 Left 925292597 2:2757569-2757591 CCTCTCGGGCAATTCCATTCCTC No data
Right 925292601 2:2757605-2757627 TTCCTCTCTGTGGACAAAACAGG No data
925292599_925292601 -6 Left 925292599 2:2757588-2757610 CCTCTTCTTTCTGCTTCTTCCTC No data
Right 925292601 2:2757605-2757627 TTCCTCTCTGTGGACAAAACAGG No data
925292598_925292601 -1 Left 925292598 2:2757583-2757605 CCATTCCTCTTCTTTCTGCTTCT No data
Right 925292601 2:2757605-2757627 TTCCTCTCTGTGGACAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925292601 Original CRISPR TTCCTCTCTGTGGACAAAAC AGG Intergenic
No off target data available for this crispr