ID: 925292602

View in Genome Browser
Species Human (GRCh38)
Location 2:2757606-2757628
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925292597_925292602 14 Left 925292597 2:2757569-2757591 CCTCTCGGGCAATTCCATTCCTC No data
Right 925292602 2:2757606-2757628 TCCTCTCTGTGGACAAAACAGGG No data
925292598_925292602 0 Left 925292598 2:2757583-2757605 CCATTCCTCTTCTTTCTGCTTCT No data
Right 925292602 2:2757606-2757628 TCCTCTCTGTGGACAAAACAGGG No data
925292599_925292602 -5 Left 925292599 2:2757588-2757610 CCTCTTCTTTCTGCTTCTTCCTC No data
Right 925292602 2:2757606-2757628 TCCTCTCTGTGGACAAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type