ID: 925292605

View in Genome Browser
Species Human (GRCh38)
Location 2:2757611-2757633
Sequence TCTGTGGACAAAACAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925292599_925292605 0 Left 925292599 2:2757588-2757610 CCTCTTCTTTCTGCTTCTTCCTC No data
Right 925292605 2:2757611-2757633 TCTGTGGACAAAACAGGGGAAGG No data
925292598_925292605 5 Left 925292598 2:2757583-2757605 CCATTCCTCTTCTTTCTGCTTCT No data
Right 925292605 2:2757611-2757633 TCTGTGGACAAAACAGGGGAAGG No data
925292597_925292605 19 Left 925292597 2:2757569-2757591 CCTCTCGGGCAATTCCATTCCTC No data
Right 925292605 2:2757611-2757633 TCTGTGGACAAAACAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925292605 Original CRISPR TCTGTGGACAAAACAGGGGA AGG Intergenic
No off target data available for this crispr