ID: 925292731

View in Genome Browser
Species Human (GRCh38)
Location 2:2758587-2758609
Sequence CAAGTTCATCAAATCCAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925292731_925292738 16 Left 925292731 2:2758587-2758609 CCAATTTGGATTTGATGAACTTG No data
Right 925292738 2:2758626-2758648 CCAGGCTGTCGGGACATGTGTGG No data
925292731_925292741 25 Left 925292731 2:2758587-2758609 CCAATTTGGATTTGATGAACTTG No data
Right 925292741 2:2758635-2758657 CGGGACATGTGTGGGACTGGTGG No data
925292731_925292742 26 Left 925292731 2:2758587-2758609 CCAATTTGGATTTGATGAACTTG No data
Right 925292742 2:2758636-2758658 GGGACATGTGTGGGACTGGTGGG No data
925292731_925292735 6 Left 925292731 2:2758587-2758609 CCAATTTGGATTTGATGAACTTG No data
Right 925292735 2:2758616-2758638 TGAAACAGACCCAGGCTGTCGGG No data
925292731_925292733 -2 Left 925292731 2:2758587-2758609 CCAATTTGGATTTGATGAACTTG No data
Right 925292733 2:2758608-2758630 TGGACACGTGAAACAGACCCAGG No data
925292731_925292734 5 Left 925292731 2:2758587-2758609 CCAATTTGGATTTGATGAACTTG No data
Right 925292734 2:2758615-2758637 GTGAAACAGACCCAGGCTGTCGG No data
925292731_925292739 17 Left 925292731 2:2758587-2758609 CCAATTTGGATTTGATGAACTTG No data
Right 925292739 2:2758627-2758649 CAGGCTGTCGGGACATGTGTGGG No data
925292731_925292740 22 Left 925292731 2:2758587-2758609 CCAATTTGGATTTGATGAACTTG No data
Right 925292740 2:2758632-2758654 TGTCGGGACATGTGTGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925292731 Original CRISPR CAAGTTCATCAAATCCAAAT TGG (reversed) Intergenic
No off target data available for this crispr