ID: 925294177

View in Genome Browser
Species Human (GRCh38)
Location 2:2766951-2766973
Sequence TATTCTTACTGGTAAAGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925294177_925294188 27 Left 925294177 2:2766951-2766973 CCACTCCTTTACCAGTAAGAATA No data
Right 925294188 2:2767001-2767023 CCCGCCTGCAGCCACCATGGTGG No data
925294177_925294186 24 Left 925294177 2:2766951-2766973 CCACTCCTTTACCAGTAAGAATA No data
Right 925294186 2:2766998-2767020 GATCCCGCCTGCAGCCACCATGG No data
925294177_925294183 -6 Left 925294177 2:2766951-2766973 CCACTCCTTTACCAGTAAGAATA No data
Right 925294183 2:2766968-2766990 AGAATAGGCCAGGGCAGCACAGG No data
925294177_925294185 2 Left 925294177 2:2766951-2766973 CCACTCCTTTACCAGTAAGAATA No data
Right 925294185 2:2766976-2766998 CCAGGGCAGCACAGGACGTATGG No data
925294177_925294190 30 Left 925294177 2:2766951-2766973 CCACTCCTTTACCAGTAAGAATA No data
Right 925294190 2:2767004-2767026 GCCTGCAGCCACCATGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925294177 Original CRISPR TATTCTTACTGGTAAAGGAG TGG (reversed) Intergenic
No off target data available for this crispr