ID: 925294179

View in Genome Browser
Species Human (GRCh38)
Location 2:2766956-2766978
Sequence TGGCCTATTCTTACTGGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925294179_925294190 25 Left 925294179 2:2766956-2766978 CCTTTACCAGTAAGAATAGGCCA No data
Right 925294190 2:2767004-2767026 GCCTGCAGCCACCATGGTGGAGG No data
925294179_925294186 19 Left 925294179 2:2766956-2766978 CCTTTACCAGTAAGAATAGGCCA No data
Right 925294186 2:2766998-2767020 GATCCCGCCTGCAGCCACCATGG No data
925294179_925294185 -3 Left 925294179 2:2766956-2766978 CCTTTACCAGTAAGAATAGGCCA No data
Right 925294185 2:2766976-2766998 CCAGGGCAGCACAGGACGTATGG No data
925294179_925294188 22 Left 925294179 2:2766956-2766978 CCTTTACCAGTAAGAATAGGCCA No data
Right 925294188 2:2767001-2767023 CCCGCCTGCAGCCACCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925294179 Original CRISPR TGGCCTATTCTTACTGGTAA AGG (reversed) Intergenic
No off target data available for this crispr