ID: 925294182

View in Genome Browser
Species Human (GRCh38)
Location 2:2766962-2766984
Sequence CTGCCCTGGCCTATTCTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925294182_925294188 16 Left 925294182 2:2766962-2766984 CCAGTAAGAATAGGCCAGGGCAG No data
Right 925294188 2:2767001-2767023 CCCGCCTGCAGCCACCATGGTGG No data
925294182_925294186 13 Left 925294182 2:2766962-2766984 CCAGTAAGAATAGGCCAGGGCAG No data
Right 925294186 2:2766998-2767020 GATCCCGCCTGCAGCCACCATGG No data
925294182_925294185 -9 Left 925294182 2:2766962-2766984 CCAGTAAGAATAGGCCAGGGCAG No data
Right 925294185 2:2766976-2766998 CCAGGGCAGCACAGGACGTATGG No data
925294182_925294190 19 Left 925294182 2:2766962-2766984 CCAGTAAGAATAGGCCAGGGCAG No data
Right 925294190 2:2767004-2767026 GCCTGCAGCCACCATGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925294182 Original CRISPR CTGCCCTGGCCTATTCTTAC TGG (reversed) Intergenic
No off target data available for this crispr