ID: 925294184

View in Genome Browser
Species Human (GRCh38)
Location 2:2766976-2766998
Sequence CCATACGTCCTGTGCTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925294184_925294190 5 Left 925294184 2:2766976-2766998 CCAGGGCAGCACAGGACGTATGG No data
Right 925294190 2:2767004-2767026 GCCTGCAGCCACCATGGTGGAGG No data
925294184_925294186 -1 Left 925294184 2:2766976-2766998 CCAGGGCAGCACAGGACGTATGG No data
Right 925294186 2:2766998-2767020 GATCCCGCCTGCAGCCACCATGG No data
925294184_925294195 25 Left 925294184 2:2766976-2766998 CCAGGGCAGCACAGGACGTATGG No data
Right 925294195 2:2767024-2767046 AGGCAGCCTGAGAAGAGAATGGG No data
925294184_925294194 24 Left 925294184 2:2766976-2766998 CCAGGGCAGCACAGGACGTATGG No data
Right 925294194 2:2767023-2767045 GAGGCAGCCTGAGAAGAGAATGG No data
925294184_925294188 2 Left 925294184 2:2766976-2766998 CCAGGGCAGCACAGGACGTATGG No data
Right 925294188 2:2767001-2767023 CCCGCCTGCAGCCACCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925294184 Original CRISPR CCATACGTCCTGTGCTGCCC TGG (reversed) Intergenic
No off target data available for this crispr