ID: 925294186

View in Genome Browser
Species Human (GRCh38)
Location 2:2766998-2767020
Sequence GATCCCGCCTGCAGCCACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925294176_925294186 29 Left 925294176 2:2766946-2766968 CCAAACCACTCCTTTACCAGTAA No data
Right 925294186 2:2766998-2767020 GATCCCGCCTGCAGCCACCATGG No data
925294179_925294186 19 Left 925294179 2:2766956-2766978 CCTTTACCAGTAAGAATAGGCCA No data
Right 925294186 2:2766998-2767020 GATCCCGCCTGCAGCCACCATGG No data
925294182_925294186 13 Left 925294182 2:2766962-2766984 CCAGTAAGAATAGGCCAGGGCAG No data
Right 925294186 2:2766998-2767020 GATCCCGCCTGCAGCCACCATGG No data
925294184_925294186 -1 Left 925294184 2:2766976-2766998 CCAGGGCAGCACAGGACGTATGG No data
Right 925294186 2:2766998-2767020 GATCCCGCCTGCAGCCACCATGG No data
925294177_925294186 24 Left 925294177 2:2766951-2766973 CCACTCCTTTACCAGTAAGAATA No data
Right 925294186 2:2766998-2767020 GATCCCGCCTGCAGCCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925294186 Original CRISPR GATCCCGCCTGCAGCCACCA TGG Intergenic
No off target data available for this crispr