ID: 925294188

View in Genome Browser
Species Human (GRCh38)
Location 2:2767001-2767023
Sequence CCCGCCTGCAGCCACCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925294184_925294188 2 Left 925294184 2:2766976-2766998 CCAGGGCAGCACAGGACGTATGG No data
Right 925294188 2:2767001-2767023 CCCGCCTGCAGCCACCATGGTGG No data
925294177_925294188 27 Left 925294177 2:2766951-2766973 CCACTCCTTTACCAGTAAGAATA No data
Right 925294188 2:2767001-2767023 CCCGCCTGCAGCCACCATGGTGG No data
925294179_925294188 22 Left 925294179 2:2766956-2766978 CCTTTACCAGTAAGAATAGGCCA No data
Right 925294188 2:2767001-2767023 CCCGCCTGCAGCCACCATGGTGG No data
925294182_925294188 16 Left 925294182 2:2766962-2766984 CCAGTAAGAATAGGCCAGGGCAG No data
Right 925294188 2:2767001-2767023 CCCGCCTGCAGCCACCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925294188 Original CRISPR CCCGCCTGCAGCCACCATGG TGG Intergenic
No off target data available for this crispr