ID: 925294194

View in Genome Browser
Species Human (GRCh38)
Location 2:2767023-2767045
Sequence GAGGCAGCCTGAGAAGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925294191_925294194 -5 Left 925294191 2:2767005-2767027 CCTGCAGCCACCATGGTGGAGGC No data
Right 925294194 2:2767023-2767045 GAGGCAGCCTGAGAAGAGAATGG No data
925294187_925294194 -1 Left 925294187 2:2767001-2767023 CCCGCCTGCAGCCACCATGGTGG No data
Right 925294194 2:2767023-2767045 GAGGCAGCCTGAGAAGAGAATGG No data
925294189_925294194 -2 Left 925294189 2:2767002-2767024 CCGCCTGCAGCCACCATGGTGGA No data
Right 925294194 2:2767023-2767045 GAGGCAGCCTGAGAAGAGAATGG No data
925294184_925294194 24 Left 925294184 2:2766976-2766998 CCAGGGCAGCACAGGACGTATGG No data
Right 925294194 2:2767023-2767045 GAGGCAGCCTGAGAAGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925294194 Original CRISPR GAGGCAGCCTGAGAAGAGAA TGG Intergenic
No off target data available for this crispr