ID: 925294195

View in Genome Browser
Species Human (GRCh38)
Location 2:2767024-2767046
Sequence AGGCAGCCTGAGAAGAGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925294187_925294195 0 Left 925294187 2:2767001-2767023 CCCGCCTGCAGCCACCATGGTGG No data
Right 925294195 2:2767024-2767046 AGGCAGCCTGAGAAGAGAATGGG No data
925294191_925294195 -4 Left 925294191 2:2767005-2767027 CCTGCAGCCACCATGGTGGAGGC No data
Right 925294195 2:2767024-2767046 AGGCAGCCTGAGAAGAGAATGGG No data
925294184_925294195 25 Left 925294184 2:2766976-2766998 CCAGGGCAGCACAGGACGTATGG No data
Right 925294195 2:2767024-2767046 AGGCAGCCTGAGAAGAGAATGGG No data
925294189_925294195 -1 Left 925294189 2:2767002-2767024 CCGCCTGCAGCCACCATGGTGGA No data
Right 925294195 2:2767024-2767046 AGGCAGCCTGAGAAGAGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925294195 Original CRISPR AGGCAGCCTGAGAAGAGAAT GGG Intergenic
No off target data available for this crispr