ID: 925295646

View in Genome Browser
Species Human (GRCh38)
Location 2:2774730-2774752
Sequence GTCCCAGGGGACCAAGGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925295646_925295653 -3 Left 925295646 2:2774730-2774752 CCCTTGCCTTGGTCCCCTGGGAC No data
Right 925295653 2:2774750-2774772 GACTCCTTCCCTGGCCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925295646 Original CRISPR GTCCCAGGGGACCAAGGCAA GGG (reversed) Intergenic
No off target data available for this crispr