ID: 925295721

View in Genome Browser
Species Human (GRCh38)
Location 2:2775387-2775409
Sequence GCTGATCCCCAGACAGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925295718_925295721 7 Left 925295718 2:2775357-2775379 CCTGGACATAGAGTAAGAGGTAC No data
Right 925295721 2:2775387-2775409 GCTGATCCCCAGACAGTGTATGG No data
925295714_925295721 24 Left 925295714 2:2775340-2775362 CCAACCCTTGCAGCAAGCCTGGA No data
Right 925295721 2:2775387-2775409 GCTGATCCCCAGACAGTGTATGG No data
925295716_925295721 19 Left 925295716 2:2775345-2775367 CCTTGCAGCAAGCCTGGACATAG No data
Right 925295721 2:2775387-2775409 GCTGATCCCCAGACAGTGTATGG No data
925295715_925295721 20 Left 925295715 2:2775344-2775366 CCCTTGCAGCAAGCCTGGACATA No data
Right 925295721 2:2775387-2775409 GCTGATCCCCAGACAGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925295721 Original CRISPR GCTGATCCCCAGACAGTGTA TGG Intergenic
No off target data available for this crispr