ID: 925296134

View in Genome Browser
Species Human (GRCh38)
Location 2:2778828-2778850
Sequence ACTAAGACATGGAGGCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925296134_925296142 5 Left 925296134 2:2778828-2778850 CCCTCTGGCCTCCATGTCTTAGT No data
Right 925296142 2:2778856-2778878 TCATGGGTTCTTCTTTTCCACGG No data
925296134_925296144 24 Left 925296134 2:2778828-2778850 CCCTCTGGCCTCCATGTCTTAGT No data
Right 925296144 2:2778875-2778897 ACGGCCTCCTTACTTTATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925296134 Original CRISPR ACTAAGACATGGAGGCCAGA GGG (reversed) Intergenic
No off target data available for this crispr