ID: 925296934

View in Genome Browser
Species Human (GRCh38)
Location 2:2783514-2783536
Sequence GAGCCCGTATCCCATGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925296934_925296938 -9 Left 925296934 2:2783514-2783536 CCCAGGGCATGGGATACGGGCTC No data
Right 925296938 2:2783528-2783550 TACGGGCTCCCAAGGGTTCTCGG No data
925296934_925296941 2 Left 925296934 2:2783514-2783536 CCCAGGGCATGGGATACGGGCTC No data
Right 925296941 2:2783539-2783561 AAGGGTTCTCGGCTCTGCACTGG No data
925296934_925296942 14 Left 925296934 2:2783514-2783536 CCCAGGGCATGGGATACGGGCTC No data
Right 925296942 2:2783551-2783573 CTCTGCACTGGAGAAGCAGCAGG No data
925296934_925296943 20 Left 925296934 2:2783514-2783536 CCCAGGGCATGGGATACGGGCTC No data
Right 925296943 2:2783557-2783579 ACTGGAGAAGCAGCAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925296934 Original CRISPR GAGCCCGTATCCCATGCCCT GGG (reversed) Intergenic
No off target data available for this crispr