ID: 925297470

View in Genome Browser
Species Human (GRCh38)
Location 2:2787424-2787446
Sequence CTCCGTGTTCATGCTGAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925297470_925297474 1 Left 925297470 2:2787424-2787446 CCCGGCTCAGCATGAACACGGAG No data
Right 925297474 2:2787448-2787470 ATGTCCCAGGATGCACAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925297470 Original CRISPR CTCCGTGTTCATGCTGAGCC GGG (reversed) Intergenic
No off target data available for this crispr