ID: 925297500

View in Genome Browser
Species Human (GRCh38)
Location 2:2787613-2787635
Sequence CCTGAATTCCGACTCTGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925297500_925297508 18 Left 925297500 2:2787613-2787635 CCTGTGCAGAGTCGGAATTCAGG No data
Right 925297508 2:2787654-2787676 TTGAGTCGGCGAGGTCGGCCAGG No data
925297500_925297507 13 Left 925297500 2:2787613-2787635 CCTGTGCAGAGTCGGAATTCAGG No data
Right 925297507 2:2787649-2787671 GAGGCTTGAGTCGGCGAGGTCGG No data
925297500_925297504 -6 Left 925297500 2:2787613-2787635 CCTGTGCAGAGTCGGAATTCAGG No data
Right 925297504 2:2787630-2787652 TTCAGGATGTGGCAGAGGTGAGG No data
925297500_925297509 28 Left 925297500 2:2787613-2787635 CCTGTGCAGAGTCGGAATTCAGG No data
Right 925297509 2:2787664-2787686 GAGGTCGGCCAGGCTCTGCAAGG No data
925297500_925297506 9 Left 925297500 2:2787613-2787635 CCTGTGCAGAGTCGGAATTCAGG No data
Right 925297506 2:2787645-2787667 AGGTGAGGCTTGAGTCGGCGAGG No data
925297500_925297505 4 Left 925297500 2:2787613-2787635 CCTGTGCAGAGTCGGAATTCAGG No data
Right 925297505 2:2787640-2787662 GGCAGAGGTGAGGCTTGAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925297500 Original CRISPR CCTGAATTCCGACTCTGCAC AGG (reversed) Intergenic
No off target data available for this crispr