ID: 925299493

View in Genome Browser
Species Human (GRCh38)
Location 2:2800408-2800430
Sequence TTCCTGCCACATCACAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925299493_925299497 -5 Left 925299493 2:2800408-2800430 CCCTCACTGTGATGTGGCAGGAA No data
Right 925299497 2:2800426-2800448 AGGAAAGGTCACTGTGATCAGGG No data
925299493_925299496 -6 Left 925299493 2:2800408-2800430 CCCTCACTGTGATGTGGCAGGAA No data
Right 925299496 2:2800425-2800447 CAGGAAAGGTCACTGTGATCAGG No data
925299493_925299499 27 Left 925299493 2:2800408-2800430 CCCTCACTGTGATGTGGCAGGAA No data
Right 925299499 2:2800458-2800480 TTTATCTATTCCGCACCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925299493 Original CRISPR TTCCTGCCACATCACAGTGA GGG (reversed) Intergenic
No off target data available for this crispr