ID: 925299559

View in Genome Browser
Species Human (GRCh38)
Location 2:2800877-2800899
Sequence GAAAATGCACACATGCACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925299559_925299563 21 Left 925299559 2:2800877-2800899 CCATGGTGCATGTGTGCATTTTC No data
Right 925299563 2:2800921-2800943 ACAGTCCCACCTCATTGCATAGG No data
925299559_925299567 28 Left 925299559 2:2800877-2800899 CCATGGTGCATGTGTGCATTTTC No data
Right 925299567 2:2800928-2800950 CACCTCATTGCATAGGAGGCTGG No data
925299559_925299564 24 Left 925299559 2:2800877-2800899 CCATGGTGCATGTGTGCATTTTC No data
Right 925299564 2:2800924-2800946 GTCCCACCTCATTGCATAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925299559 Original CRISPR GAAAATGCACACATGCACCA TGG (reversed) Intergenic
No off target data available for this crispr