ID: 925300193

View in Genome Browser
Species Human (GRCh38)
Location 2:2806316-2806338
Sequence CACACGGCCGGGCCACCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925300183_925300193 -9 Left 925300183 2:2806302-2806324 CCCCCACCCCTCCGCACACGGCC No data
Right 925300193 2:2806316-2806338 CACACGGCCGGGCCACCCCCCGG No data
925300179_925300193 20 Left 925300179 2:2806273-2806295 CCGAGATGGAGCCTGATGGTGGC No data
Right 925300193 2:2806316-2806338 CACACGGCCGGGCCACCCCCCGG No data
925300181_925300193 9 Left 925300181 2:2806284-2806306 CCTGATGGTGGCAACAGGCCCCC No data
Right 925300193 2:2806316-2806338 CACACGGCCGGGCCACCCCCCGG No data
925300184_925300193 -10 Left 925300184 2:2806303-2806325 CCCCACCCCTCCGCACACGGCCG No data
Right 925300193 2:2806316-2806338 CACACGGCCGGGCCACCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925300193 Original CRISPR CACACGGCCGGGCCACCCCC CGG Intergenic
No off target data available for this crispr