ID: 925303048

View in Genome Browser
Species Human (GRCh38)
Location 2:2830508-2830530
Sequence CTGCAGCCAGAAATGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925303048_925303052 -1 Left 925303048 2:2830508-2830530 CCCAGCACCATTTCTGGCTGCAG No data
Right 925303052 2:2830530-2830552 GCATTCACACAGCAGCAGGAAGG No data
925303048_925303051 -5 Left 925303048 2:2830508-2830530 CCCAGCACCATTTCTGGCTGCAG No data
Right 925303051 2:2830526-2830548 TGCAGCATTCACACAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925303048 Original CRISPR CTGCAGCCAGAAATGGTGCT GGG (reversed) Intergenic
No off target data available for this crispr