ID: 925303871

View in Genome Browser
Species Human (GRCh38)
Location 2:2835691-2835713
Sequence ACATGGGCCTCTGTGGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925303859_925303871 2 Left 925303859 2:2835666-2835688 CCCACCCCATTTCACCCTTGCAG No data
Right 925303871 2:2835691-2835713 ACATGGGCCTCTGTGGGTCCTGG No data
925303863_925303871 -4 Left 925303863 2:2835672-2835694 CCATTTCACCCTTGCAGCCACAT No data
Right 925303871 2:2835691-2835713 ACATGGGCCTCTGTGGGTCCTGG No data
925303858_925303871 6 Left 925303858 2:2835662-2835684 CCGTCCCACCCCATTTCACCCTT No data
Right 925303871 2:2835691-2835713 ACATGGGCCTCTGTGGGTCCTGG No data
925303862_925303871 -3 Left 925303862 2:2835671-2835693 CCCATTTCACCCTTGCAGCCACA No data
Right 925303871 2:2835691-2835713 ACATGGGCCTCTGTGGGTCCTGG No data
925303860_925303871 1 Left 925303860 2:2835667-2835689 CCACCCCATTTCACCCTTGCAGC No data
Right 925303871 2:2835691-2835713 ACATGGGCCTCTGTGGGTCCTGG No data
925303861_925303871 -2 Left 925303861 2:2835670-2835692 CCCCATTTCACCCTTGCAGCCAC No data
Right 925303871 2:2835691-2835713 ACATGGGCCTCTGTGGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925303871 Original CRISPR ACATGGGCCTCTGTGGGTCC TGG Intergenic
No off target data available for this crispr