ID: 925306576

View in Genome Browser
Species Human (GRCh38)
Location 2:2851225-2851247
Sequence CACCGTTTGCTCTCCTGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925306569_925306576 -8 Left 925306569 2:2851210-2851232 CCAGGCGACACCCCCCACCGTTT No data
Right 925306576 2:2851225-2851247 CACCGTTTGCTCTCCTGCATGGG No data
925306565_925306576 22 Left 925306565 2:2851180-2851202 CCCCTTTCTAAAGGCAGTTTATC No data
Right 925306576 2:2851225-2851247 CACCGTTTGCTCTCCTGCATGGG No data
925306566_925306576 21 Left 925306566 2:2851181-2851203 CCCTTTCTAAAGGCAGTTTATCA No data
Right 925306576 2:2851225-2851247 CACCGTTTGCTCTCCTGCATGGG No data
925306567_925306576 20 Left 925306567 2:2851182-2851204 CCTTTCTAAAGGCAGTTTATCAC No data
Right 925306576 2:2851225-2851247 CACCGTTTGCTCTCCTGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925306576 Original CRISPR CACCGTTTGCTCTCCTGCAT GGG Intergenic