ID: 925306639

View in Genome Browser
Species Human (GRCh38)
Location 2:2851480-2851502
Sequence CTGGAGACAGGCTCCCTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925306634_925306639 -5 Left 925306634 2:2851462-2851484 CCCTCGCACGCACAGCCTCTGGA No data
Right 925306639 2:2851480-2851502 CTGGAGACAGGCTCCCTCCTGGG No data
925306629_925306639 13 Left 925306629 2:2851444-2851466 CCCTAGCTCAGCCTCTGCCCCTC No data
Right 925306639 2:2851480-2851502 CTGGAGACAGGCTCCCTCCTGGG No data
925306631_925306639 2 Left 925306631 2:2851455-2851477 CCTCTGCCCCTCGCACGCACAGC No data
Right 925306639 2:2851480-2851502 CTGGAGACAGGCTCCCTCCTGGG No data
925306625_925306639 27 Left 925306625 2:2851430-2851452 CCCCTCAGTGACTCCCCTAGCTC No data
Right 925306639 2:2851480-2851502 CTGGAGACAGGCTCCCTCCTGGG No data
925306635_925306639 -6 Left 925306635 2:2851463-2851485 CCTCGCACGCACAGCCTCTGGAG No data
Right 925306639 2:2851480-2851502 CTGGAGACAGGCTCCCTCCTGGG No data
925306630_925306639 12 Left 925306630 2:2851445-2851467 CCTAGCTCAGCCTCTGCCCCTCG No data
Right 925306639 2:2851480-2851502 CTGGAGACAGGCTCCCTCCTGGG No data
925306626_925306639 26 Left 925306626 2:2851431-2851453 CCCTCAGTGACTCCCCTAGCTCA No data
Right 925306639 2:2851480-2851502 CTGGAGACAGGCTCCCTCCTGGG No data
925306628_925306639 14 Left 925306628 2:2851443-2851465 CCCCTAGCTCAGCCTCTGCCCCT No data
Right 925306639 2:2851480-2851502 CTGGAGACAGGCTCCCTCCTGGG No data
925306627_925306639 25 Left 925306627 2:2851432-2851454 CCTCAGTGACTCCCCTAGCTCAG No data
Right 925306639 2:2851480-2851502 CTGGAGACAGGCTCCCTCCTGGG No data
925306632_925306639 -4 Left 925306632 2:2851461-2851483 CCCCTCGCACGCACAGCCTCTGG No data
Right 925306639 2:2851480-2851502 CTGGAGACAGGCTCCCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925306639 Original CRISPR CTGGAGACAGGCTCCCTCCT GGG Intergenic
No off target data available for this crispr