ID: 925306938

View in Genome Browser
Species Human (GRCh38)
Location 2:2854490-2854512
Sequence CCTTGTAAGCAGGACATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925306938_925306942 -7 Left 925306938 2:2854490-2854512 CCTTCCATGTCCTGCTTACAAGG No data
Right 925306942 2:2854506-2854528 TACAAGGCCAGCGCCAGACATGG No data
925306938_925306944 1 Left 925306938 2:2854490-2854512 CCTTCCATGTCCTGCTTACAAGG No data
Right 925306944 2:2854514-2854536 CAGCGCCAGACATGGAAAGTTGG No data
925306938_925306946 6 Left 925306938 2:2854490-2854512 CCTTCCATGTCCTGCTTACAAGG No data
Right 925306946 2:2854519-2854541 CCAGACATGGAAAGTTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925306938 Original CRISPR CCTTGTAAGCAGGACATGGA AGG (reversed) Intergenic
No off target data available for this crispr