ID: 925310725

View in Genome Browser
Species Human (GRCh38)
Location 2:2879592-2879614
Sequence CTGTGGGTGTGCAGCCTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925310715_925310725 24 Left 925310715 2:2879545-2879567 CCGTTAGACCCTGGTACCACAAT No data
Right 925310725 2:2879592-2879614 CTGTGGGTGTGCAGCCTTCCAGG No data
925310718_925310725 15 Left 925310718 2:2879554-2879576 CCTGGTACCACAATGAACTAGGT No data
Right 925310725 2:2879592-2879614 CTGTGGGTGTGCAGCCTTCCAGG No data
925310716_925310725 16 Left 925310716 2:2879553-2879575 CCCTGGTACCACAATGAACTAGG No data
Right 925310725 2:2879592-2879614 CTGTGGGTGTGCAGCCTTCCAGG No data
925310720_925310725 8 Left 925310720 2:2879561-2879583 CCACAATGAACTAGGTGGTGAGA No data
Right 925310725 2:2879592-2879614 CTGTGGGTGTGCAGCCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925310725 Original CRISPR CTGTGGGTGTGCAGCCTTCC AGG Intergenic
No off target data available for this crispr