ID: 925312273

View in Genome Browser
Species Human (GRCh38)
Location 2:2893445-2893467
Sequence GTAATCAATGATAATAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925312273_925312275 16 Left 925312273 2:2893445-2893467 CCTGCATTATTATCATTGATTAC No data
Right 925312275 2:2893484-2893506 TGGTTGTACATGCAAGTTTCAGG No data
925312273_925312274 -4 Left 925312273 2:2893445-2893467 CCTGCATTATTATCATTGATTAC No data
Right 925312274 2:2893464-2893486 TTACATTAGCAAGTATCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925312273 Original CRISPR GTAATCAATGATAATAATGC AGG (reversed) Intergenic
No off target data available for this crispr