ID: 925315567

View in Genome Browser
Species Human (GRCh38)
Location 2:2920250-2920272
Sequence CTGCATGTTCATCTGGCACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925315558_925315567 11 Left 925315558 2:2920216-2920238 CCTGCTCTCAACAGGAGCCAGGG No data
Right 925315567 2:2920250-2920272 CTGCATGTTCATCTGGCACCGGG No data
925315556_925315567 15 Left 925315556 2:2920212-2920234 CCAACCTGCTCTCAACAGGAGCC No data
Right 925315567 2:2920250-2920272 CTGCATGTTCATCTGGCACCGGG No data
925315561_925315567 -6 Left 925315561 2:2920233-2920255 CCAGGGGCAGCCACGCCCTGCAT No data
Right 925315567 2:2920250-2920272 CTGCATGTTCATCTGGCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925315567 Original CRISPR CTGCATGTTCATCTGGCACC GGG Intergenic
No off target data available for this crispr