ID: 925315680

View in Genome Browser
Species Human (GRCh38)
Location 2:2921441-2921463
Sequence GCCCTTCCCCTGGTGTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925315670_925315680 14 Left 925315670 2:2921404-2921426 CCCAACACGATGACCAAGCATGC No data
Right 925315680 2:2921441-2921463 GCCCTTCCCCTGGTGTTGGGAGG No data
925315666_925315680 24 Left 925315666 2:2921394-2921416 CCCCACAGACCCCAACACGATGA No data
Right 925315680 2:2921441-2921463 GCCCTTCCCCTGGTGTTGGGAGG No data
925315673_925315680 1 Left 925315673 2:2921417-2921439 CCAAGCATGCTGAGCCATAGGCC No data
Right 925315680 2:2921441-2921463 GCCCTTCCCCTGGTGTTGGGAGG No data
925315671_925315680 13 Left 925315671 2:2921405-2921427 CCAACACGATGACCAAGCATGCT No data
Right 925315680 2:2921441-2921463 GCCCTTCCCCTGGTGTTGGGAGG No data
925315668_925315680 22 Left 925315668 2:2921396-2921418 CCACAGACCCCAACACGATGACC No data
Right 925315680 2:2921441-2921463 GCCCTTCCCCTGGTGTTGGGAGG No data
925315669_925315680 15 Left 925315669 2:2921403-2921425 CCCCAACACGATGACCAAGCATG No data
Right 925315680 2:2921441-2921463 GCCCTTCCCCTGGTGTTGGGAGG No data
925315665_925315680 25 Left 925315665 2:2921393-2921415 CCCCCACAGACCCCAACACGATG No data
Right 925315680 2:2921441-2921463 GCCCTTCCCCTGGTGTTGGGAGG No data
925315667_925315680 23 Left 925315667 2:2921395-2921417 CCCACAGACCCCAACACGATGAC No data
Right 925315680 2:2921441-2921463 GCCCTTCCCCTGGTGTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925315680 Original CRISPR GCCCTTCCCCTGGTGTTGGG AGG Intergenic
No off target data available for this crispr