ID: 925316514

View in Genome Browser
Species Human (GRCh38)
Location 2:2930693-2930715
Sequence CTTTACCCTGAGTTCAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925316514_925316518 -9 Left 925316514 2:2930693-2930715 CCCCACCTGAACTCAGGGTAAAG No data
Right 925316518 2:2930707-2930729 AGGGTAAAGCCATGAAGTGCAGG No data
925316514_925316519 -3 Left 925316514 2:2930693-2930715 CCCCACCTGAACTCAGGGTAAAG No data
Right 925316519 2:2930713-2930735 AAGCCATGAAGTGCAGGCCCAGG No data
925316514_925316522 1 Left 925316514 2:2930693-2930715 CCCCACCTGAACTCAGGGTAAAG No data
Right 925316522 2:2930717-2930739 CATGAAGTGCAGGCCCAGGAGGG No data
925316514_925316521 0 Left 925316514 2:2930693-2930715 CCCCACCTGAACTCAGGGTAAAG No data
Right 925316521 2:2930716-2930738 CCATGAAGTGCAGGCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925316514 Original CRISPR CTTTACCCTGAGTTCAGGTG GGG (reversed) Intergenic