ID: 925316516

View in Genome Browser
Species Human (GRCh38)
Location 2:2930695-2930717
Sequence GGCTTTACCCTGAGTTCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925316516_925316522 -1 Left 925316516 2:2930695-2930717 CCACCTGAACTCAGGGTAAAGCC No data
Right 925316522 2:2930717-2930739 CATGAAGTGCAGGCCCAGGAGGG No data
925316516_925316519 -5 Left 925316516 2:2930695-2930717 CCACCTGAACTCAGGGTAAAGCC No data
Right 925316519 2:2930713-2930735 AAGCCATGAAGTGCAGGCCCAGG No data
925316516_925316521 -2 Left 925316516 2:2930695-2930717 CCACCTGAACTCAGGGTAAAGCC No data
Right 925316521 2:2930716-2930738 CCATGAAGTGCAGGCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925316516 Original CRISPR GGCTTTACCCTGAGTTCAGG TGG (reversed) Intergenic
No off target data available for this crispr