ID: 925316517

View in Genome Browser
Species Human (GRCh38)
Location 2:2930698-2930720
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925316517_925316522 -4 Left 925316517 2:2930698-2930720 CCTGAACTCAGGGTAAAGCCATG No data
Right 925316522 2:2930717-2930739 CATGAAGTGCAGGCCCAGGAGGG No data
925316517_925316521 -5 Left 925316517 2:2930698-2930720 CCTGAACTCAGGGTAAAGCCATG No data
Right 925316521 2:2930716-2930738 CCATGAAGTGCAGGCCCAGGAGG No data
925316517_925316519 -8 Left 925316517 2:2930698-2930720 CCTGAACTCAGGGTAAAGCCATG No data
Right 925316519 2:2930713-2930735 AAGCCATGAAGTGCAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925316517 Original CRISPR CATGGCTTTACCCTGAGTTC AGG (reversed) Intergenic