ID: 925316522

View in Genome Browser
Species Human (GRCh38)
Location 2:2930717-2930739
Sequence CATGAAGTGCAGGCCCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925316515_925316522 0 Left 925316515 2:2930694-2930716 CCCACCTGAACTCAGGGTAAAGC No data
Right 925316522 2:2930717-2930739 CATGAAGTGCAGGCCCAGGAGGG No data
925316517_925316522 -4 Left 925316517 2:2930698-2930720 CCTGAACTCAGGGTAAAGCCATG No data
Right 925316522 2:2930717-2930739 CATGAAGTGCAGGCCCAGGAGGG No data
925316514_925316522 1 Left 925316514 2:2930693-2930715 CCCCACCTGAACTCAGGGTAAAG No data
Right 925316522 2:2930717-2930739 CATGAAGTGCAGGCCCAGGAGGG No data
925316516_925316522 -1 Left 925316516 2:2930695-2930717 CCACCTGAACTCAGGGTAAAGCC No data
Right 925316522 2:2930717-2930739 CATGAAGTGCAGGCCCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925316522 Original CRISPR CATGAAGTGCAGGCCCAGGA GGG Intergenic