ID: 925318107

View in Genome Browser
Species Human (GRCh38)
Location 2:2940446-2940468
Sequence CCCCAGAGCCTGCCCCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925318105_925318107 0 Left 925318105 2:2940423-2940445 CCAGAACACAGGGGTCGAGAGGT No data
Right 925318107 2:2940446-2940468 CCCCAGAGCCTGCCCCTGCCAGG No data
925318095_925318107 18 Left 925318095 2:2940405-2940427 CCCTGAGCCTGTCCCCTGCCAGA No data
Right 925318107 2:2940446-2940468 CCCCAGAGCCTGCCCCTGCCAGG No data
925318094_925318107 19 Left 925318094 2:2940404-2940426 CCCCTGAGCCTGTCCCCTGCCAG No data
Right 925318107 2:2940446-2940468 CCCCAGAGCCTGCCCCTGCCAGG No data
925318102_925318107 5 Left 925318102 2:2940418-2940440 CCCTGCCAGAACACAGGGGTCGA No data
Right 925318107 2:2940446-2940468 CCCCAGAGCCTGCCCCTGCCAGG No data
925318097_925318107 11 Left 925318097 2:2940412-2940434 CCTGTCCCCTGCCAGAACACAGG No data
Right 925318107 2:2940446-2940468 CCCCAGAGCCTGCCCCTGCCAGG No data
925318096_925318107 17 Left 925318096 2:2940406-2940428 CCTGAGCCTGTCCCCTGCCAGAA No data
Right 925318107 2:2940446-2940468 CCCCAGAGCCTGCCCCTGCCAGG No data
925318101_925318107 6 Left 925318101 2:2940417-2940439 CCCCTGCCAGAACACAGGGGTCG No data
Right 925318107 2:2940446-2940468 CCCCAGAGCCTGCCCCTGCCAGG No data
925318103_925318107 4 Left 925318103 2:2940419-2940441 CCTGCCAGAACACAGGGGTCGAG No data
Right 925318107 2:2940446-2940468 CCCCAGAGCCTGCCCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925318107 Original CRISPR CCCCAGAGCCTGCCCCTGCC AGG Intergenic
No off target data available for this crispr