ID: 925318484

View in Genome Browser
Species Human (GRCh38)
Location 2:2942700-2942722
Sequence CTCCCTTTCAGCCCTGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925318484_925318485 3 Left 925318484 2:2942700-2942722 CCAGTCTCAGGGCTGAAAGGGAG No data
Right 925318485 2:2942726-2942748 CACATGAAAGTCCTTTGCTCTGG No data
925318484_925318486 4 Left 925318484 2:2942700-2942722 CCAGTCTCAGGGCTGAAAGGGAG No data
Right 925318486 2:2942727-2942749 ACATGAAAGTCCTTTGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925318484 Original CRISPR CTCCCTTTCAGCCCTGAGAC TGG (reversed) Intergenic
No off target data available for this crispr