ID: 925321338

View in Genome Browser
Species Human (GRCh38)
Location 2:2971777-2971799
Sequence CATTCCAGGAAGAAATTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925321338_925321344 23 Left 925321338 2:2971777-2971799 CCCTCCAATTTCTTCCTGGAATG No data
Right 925321344 2:2971823-2971845 GCAGCCATGTTGAGACCATGAGG No data
925321338_925321343 -5 Left 925321338 2:2971777-2971799 CCCTCCAATTTCTTCCTGGAATG No data
Right 925321343 2:2971795-2971817 GAATGCAGACAAGATGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925321338 Original CRISPR CATTCCAGGAAGAAATTGGA GGG (reversed) Intergenic
No off target data available for this crispr