ID: 925321343

View in Genome Browser
Species Human (GRCh38)
Location 2:2971795-2971817
Sequence GAATGCAGACAAGATGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925321334_925321343 6 Left 925321334 2:2971766-2971788 CCTAGGCCCTGCCCTCCAATTTC No data
Right 925321343 2:2971795-2971817 GAATGCAGACAAGATGGCTGAGG No data
925321333_925321343 7 Left 925321333 2:2971765-2971787 CCCTAGGCCCTGCCCTCCAATTT No data
Right 925321343 2:2971795-2971817 GAATGCAGACAAGATGGCTGAGG No data
925321335_925321343 0 Left 925321335 2:2971772-2971794 CCCTGCCCTCCAATTTCTTCCTG No data
Right 925321343 2:2971795-2971817 GAATGCAGACAAGATGGCTGAGG No data
925321339_925321343 -6 Left 925321339 2:2971778-2971800 CCTCCAATTTCTTCCTGGAATGC No data
Right 925321343 2:2971795-2971817 GAATGCAGACAAGATGGCTGAGG No data
925321338_925321343 -5 Left 925321338 2:2971777-2971799 CCCTCCAATTTCTTCCTGGAATG No data
Right 925321343 2:2971795-2971817 GAATGCAGACAAGATGGCTGAGG No data
925321330_925321343 16 Left 925321330 2:2971756-2971778 CCCCTTGGTCCCTAGGCCCTGCC No data
Right 925321343 2:2971795-2971817 GAATGCAGACAAGATGGCTGAGG No data
925321340_925321343 -9 Left 925321340 2:2971781-2971803 CCAATTTCTTCCTGGAATGCAGA No data
Right 925321343 2:2971795-2971817 GAATGCAGACAAGATGGCTGAGG No data
925321336_925321343 -1 Left 925321336 2:2971773-2971795 CCTGCCCTCCAATTTCTTCCTGG No data
Right 925321343 2:2971795-2971817 GAATGCAGACAAGATGGCTGAGG No data
925321331_925321343 15 Left 925321331 2:2971757-2971779 CCCTTGGTCCCTAGGCCCTGCCC No data
Right 925321343 2:2971795-2971817 GAATGCAGACAAGATGGCTGAGG No data
925321332_925321343 14 Left 925321332 2:2971758-2971780 CCTTGGTCCCTAGGCCCTGCCCT No data
Right 925321343 2:2971795-2971817 GAATGCAGACAAGATGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925321343 Original CRISPR GAATGCAGACAAGATGGCTG AGG Intergenic
No off target data available for this crispr