ID: 925321344

View in Genome Browser
Species Human (GRCh38)
Location 2:2971823-2971845
Sequence GCAGCCATGTTGAGACCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925321338_925321344 23 Left 925321338 2:2971777-2971799 CCCTCCAATTTCTTCCTGGAATG No data
Right 925321344 2:2971823-2971845 GCAGCCATGTTGAGACCATGAGG No data
925321342_925321344 9 Left 925321342 2:2971791-2971813 CCTGGAATGCAGACAAGATGGCT No data
Right 925321344 2:2971823-2971845 GCAGCCATGTTGAGACCATGAGG No data
925321339_925321344 22 Left 925321339 2:2971778-2971800 CCTCCAATTTCTTCCTGGAATGC No data
Right 925321344 2:2971823-2971845 GCAGCCATGTTGAGACCATGAGG No data
925321335_925321344 28 Left 925321335 2:2971772-2971794 CCCTGCCCTCCAATTTCTTCCTG No data
Right 925321344 2:2971823-2971845 GCAGCCATGTTGAGACCATGAGG No data
925321340_925321344 19 Left 925321340 2:2971781-2971803 CCAATTTCTTCCTGGAATGCAGA No data
Right 925321344 2:2971823-2971845 GCAGCCATGTTGAGACCATGAGG No data
925321336_925321344 27 Left 925321336 2:2971773-2971795 CCTGCCCTCCAATTTCTTCCTGG No data
Right 925321344 2:2971823-2971845 GCAGCCATGTTGAGACCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925321344 Original CRISPR GCAGCCATGTTGAGACCATG AGG Intergenic
No off target data available for this crispr