ID: 925323161

View in Genome Browser
Species Human (GRCh38)
Location 2:2992768-2992790
Sequence AAGGACACTCACACCAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925323156_925323161 11 Left 925323156 2:2992734-2992756 CCCTAGAGACACTATGGGAGCCT No data
Right 925323161 2:2992768-2992790 AAGGACACTCACACCAAACAGGG No data
925323157_925323161 10 Left 925323157 2:2992735-2992757 CCTAGAGACACTATGGGAGCCTC No data
Right 925323161 2:2992768-2992790 AAGGACACTCACACCAAACAGGG No data
925323159_925323161 -9 Left 925323159 2:2992754-2992776 CCTCATGACTCTAAAAGGACACT No data
Right 925323161 2:2992768-2992790 AAGGACACTCACACCAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925323161 Original CRISPR AAGGACACTCACACCAAACA GGG Intergenic
No off target data available for this crispr