ID: 925324805

View in Genome Browser
Species Human (GRCh38)
Location 2:3010046-3010068
Sequence CCCTGAAGACGGTCTTGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925324798_925324805 14 Left 925324798 2:3010009-3010031 CCTGGTTGATGAGAGTTGAAATG No data
Right 925324805 2:3010046-3010068 CCCTGAAGACGGTCTTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925324805 Original CRISPR CCCTGAAGACGGTCTTGGGC AGG Intergenic
No off target data available for this crispr