ID: 925327953

View in Genome Browser
Species Human (GRCh38)
Location 2:3037342-3037364
Sequence GGGACCCCGTGGACGCACCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925327953_925327961 8 Left 925327953 2:3037342-3037364 CCCCGGTGCGTCCACGGGGTCCC No data
Right 925327961 2:3037373-3037395 TGTCAGTACAGCTGACACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925327953 Original CRISPR GGGACCCCGTGGACGCACCG GGG (reversed) Intergenic
No off target data available for this crispr