ID: 925331551

View in Genome Browser
Species Human (GRCh38)
Location 2:3062685-3062707
Sequence TCTCCCAGAACCACCACAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925331546_925331551 2 Left 925331546 2:3062660-3062682 CCCTGCAGCACACTCAGGGGAGC No data
Right 925331551 2:3062685-3062707 TCTCCCAGAACCACCACAGGGGG No data
925331547_925331551 1 Left 925331547 2:3062661-3062683 CCTGCAGCACACTCAGGGGAGCA No data
Right 925331551 2:3062685-3062707 TCTCCCAGAACCACCACAGGGGG No data
925331544_925331551 5 Left 925331544 2:3062657-3062679 CCTCCCTGCAGCACACTCAGGGG No data
Right 925331551 2:3062685-3062707 TCTCCCAGAACCACCACAGGGGG No data
925331541_925331551 15 Left 925331541 2:3062647-3062669 CCAGAAATCACCTCCCTGCAGCA No data
Right 925331551 2:3062685-3062707 TCTCCCAGAACCACCACAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925331551 Original CRISPR TCTCCCAGAACCACCACAGG GGG Intergenic
No off target data available for this crispr