ID: 925331621

View in Genome Browser
Species Human (GRCh38)
Location 2:3063053-3063075
Sequence GGCCAGAGGCTGACTCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925331612_925331621 8 Left 925331612 2:3063022-3063044 CCACACAGACCTCAAGGAGAGGG No data
Right 925331621 2:3063053-3063075 GGCCAGAGGCTGACTCAGCCAGG No data
925331616_925331621 -1 Left 925331616 2:3063031-3063053 CCTCAAGGAGAGGGCCAGGTGGG No data
Right 925331621 2:3063053-3063075 GGCCAGAGGCTGACTCAGCCAGG No data
925331609_925331621 18 Left 925331609 2:3063012-3063034 CCTGAGAAGGCCACACAGACCTC No data
Right 925331621 2:3063053-3063075 GGCCAGAGGCTGACTCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925331621 Original CRISPR GGCCAGAGGCTGACTCAGCC AGG Intergenic
No off target data available for this crispr