ID: 925332461

View in Genome Browser
Species Human (GRCh38)
Location 2:3069409-3069431
Sequence CCCGTGGGGCACCCAAGGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925332461_925332472 2 Left 925332461 2:3069409-3069431 CCCGTCCTTGGGTGCCCCACGGG No data
Right 925332472 2:3069434-3069456 CTGGAAGGGCATCCTCTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925332461 Original CRISPR CCCGTGGGGCACCCAAGGAC GGG (reversed) Intergenic
No off target data available for this crispr