ID: 925333185

View in Genome Browser
Species Human (GRCh38)
Location 2:3074553-3074575
Sequence TTGGTAACACACACCCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925333185_925333190 30 Left 925333185 2:3074553-3074575 CCCACATGGGTGTGTGTTACCAA No data
Right 925333190 2:3074606-3074628 TTGTGTGTTAATGAGCACAATGG No data
925333185_925333188 6 Left 925333185 2:3074553-3074575 CCCACATGGGTGTGTGTTACCAA No data
Right 925333188 2:3074582-3074604 TTAGATTTGCCATCTGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925333185 Original CRISPR TTGGTAACACACACCCATGT GGG (reversed) Intergenic
No off target data available for this crispr